I had problems figuring out your sentence as you didn't include the required start/stop codons, so I didn't know where to start the translation process. As such, I just had to begin at the first base, and as such, the sentence didn't make sense.
Please respond with the correct sentence and perhaps an explanation of where the translation was supposed to begin.
Here is my decode for reference:
DNA: ATTCATGGTTCATTTGCAATATAACTCAGGGTAGGCC RNA/Codons: UAA GUA CCA AGU AAA CGU UAU AUU GAG UCC CAU CCG G An you sit ape delirium learn of students sleepy into sleep study G
I can see why it's incoherent. I added 4 random codes at the beginning and the end at the behest of the pdf's instructions. The first 4 letters are supposed to be disregarded, the start of the sentence begins at ATG and ends at TAG which are the start and stop codons. The sentence is as follows: I sleep to dream of anthropology and natural selection.
Christian, you were correct in adding the random bases, but you were missing the very important start/stop codons, so your decoder didn't know where to start. Make sure you follow the guidelines carefully.
Christian,
ReplyDeleteI will provide you with a decode.
I had problems figuring out your sentence as you didn't include the required start/stop codons, so I didn't know where to start the translation process. As such, I just had to begin at the first base, and as such, the sentence didn't make sense.
Please respond with the correct sentence and perhaps an explanation of where the translation was supposed to begin.
Here is my decode for reference:
DNA: ATTCATGGTTCATTTGCAATATAACTCAGGGTAGGCC
RNA/Codons: UAA GUA CCA AGU AAA CGU UAU AUU GAG UCC CAU CCG G
An you sit ape delirium learn of students sleepy into sleep study G
I can see why it's incoherent. I added 4 random codes at the beginning and the end at the behest of the pdf's instructions. The first 4 letters are supposed to be disregarded, the start of the sentence begins at ATG and ends at TAG which are the start and stop codons.
DeleteThe sentence is as follows:
I sleep to dream of anthropology and natural selection.
Christian, you were correct in adding the random bases, but you were missing the very important start/stop codons, so your decoder didn't know where to start. Make sure you follow the guidelines carefully.
ReplyDeleteThank you for the response.